» Site Navigation
5 members and 2,281 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,179
Threads: 248,609
Posts: 2,569,182
Top Poster: JLC (31,651)
|
-
-
-
New Member
Re: What does that mean? Herp abbreviations & acronyms
Posting that list was a great idea. I learned a new one today (dinker) & think it will help a lot of folks not familiar with reptile speak!
-
-
Re: What does that mean? Herp abbreviations & acronyms
Originally Posted by crystal
heres a quick one
what is the BOI
and can that go on here?
The BOI is the Board of Inquiry here is the link to it http://www.faunaclassifieds.com/foru...splay.php?f=13
-
-
Re: What does that mean? Herp abbreviations & acronyms
Added BOI to the list above.
-
-
BPnet Veteran
Re: What does that mean? Herp abbreviations & acronyms
Thought of another acronym that you might see around here:
SVL - snout-to-vent length, the length of an animal measured from the tip of its snout to its vent (cloaca).
-
-
Re: What does that mean? Herp abbreviations & acronyms
I would redo your definition of "het" because the way it is written sounds to me like you are talking about 2 different unrelated genes.
I believe the prefered definition (at least among geneticists) is that a "het" is 2 different alleles of a specific gene.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: What does that mean? Herp abbreviations & acronyms
Forgot an important one- BP- Ball python
- Matt
Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat
-
-
BPnet Veteran
Re: What does that mean? Herp abbreviations & acronyms
OP-Original Poster
...I didn't know what that one actually stood for FOREVER.
-
-
Re: What does that mean? Herp abbreviations & acronyms
Hows about STP's short tailed pythons or if your a rock and roller
stone temple pilots..
-
The Following 2 Users Say Thank You to Tim Mead For This Useful Post:
Capray (10-18-2012),tsdsbd (07-17-2010)
-
Registered User
Re: What does that mean? Herp abbreviations & acronyms
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|